Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Sample collection and DNA extraction br

    2020-08-14


    2.3. Sample collection and DNA extraction
    Three milliliters of blood was collected from a peripheral vein into EDTA-coated tube from every participant. Genomic DNA was extracted using G-spin™ Total DNA Kit in accordance with the instructions pro-vided by the manufacturer (iNtRON Biotechnology, Inc., 2012, Korea). The purity of the extracted DNA was checked by UV/VIS Spectrophotometer (Model No. JENWAY 6305, JENWAY Ltd., UK).
    2.4. Polymerase chain reaction - restriction fragment length polymorphism
    Amplification and genotyping was performed by Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) assay. The primers for the two SNPs were as detailed below:
    rs3020314 Forward primer 5′GCTCTCTAAGGCTGTGACATTTCT3′
    Reverse primer 5′TTTCCTTGCGTTTCACCAGAGCTT3′
    rs1643821 Forward primer 5′CACACAGAATAGGAAAAAGGCTAAG3′
    Reverse primer 5′CCTCCATAAAATTTGAAGCAGTCAG3′
    The amplification of the template was carried-out according to Maxime PCR PreMix Kit (i-Taq) manufacturer's protocol (iNtRON Biotechnology, Inc., Korea). For rs3020314 an initial denaturation at 94 °C for 5 min, followed by 40 cycles (denaturation at 94 °C for 30 s, annealing temperature at 58 °C for 40 s, and extension at 72 °C for 30 s), then a final extension GastrinI at 72 °C for 5 min; a PCR product of 703 bp was generated. Similarly for rs1643821 an initial denaturation at 94 °C for 5 min, followed by 35 cycles (denaturation at 94 °C for 30 s, an-nealing temperature at 59 °C for 30 s, and extension at 72 °C for 30 s), then a final extension cycle at 72 °C for 5 min; a PCR product of 623 bp was produced. The PCR products were digested by BsmAI and Hpy188III endonucleases (New England Biolabs, Ipswich, MA, USA) for rs3020314 of and rs1643821 respectively; The DNA fragments were loaded in 2% agarose gel, electrophoresis was performed and the re-sulting bands were visualized using automated gel documentation system from Syngene, UK.
    Data regarding demographic, clinical features of breast cancer and genotyping were analyzed using different statistical software. The allele and genotype frequencies, Hardy–Weinberg equilibrium (HWE) devia-tion, linkage disequilibrium and haplotype frequencies were evaluated using PLINK software (Purcell et al., 2007) version 1.07 and Haploveiw (Barrett et al., 2005) version 4.2. Statistical Package for the Social Sciences, version 16.0 (SPSS Inc., Chicago, IL, USA) was used to com-pare genotype frequencies of cases and controls with demographic
    A.T. Gebreslasie, et al.
    Table 1
    Characteristics of the breast cancer patients and control participants.
    Characteristics Patients
    Controls
    Total no. Mean ± SD Total no. Mean ± SD
    Menopausal status 70
    Premenopausal
    Postmenopausal
    Family history of breast 59
    cancer
    No
    Yes
    Tumor stage 60
    Lymph node 60
    Negative
    Positive
    Metastases 62
    Mx
    Histological type 67
    Ductal
    Lobular
    Estrogen receptor 53
    Positive
    Negative
    Progesterone receptor 52
    Positive
    Negative
    variables. The association between the genotypes and risk factors of breast cancer were evaluated by binary logistic regression in terms of odds ratio with 95% confidence intervals. p-Values < 0.05 were con-sidered statistically significant.
    3. Results
    3.1. Characteristics of the study groups
    The study included 71 women diagnosed with breast cancer (pa-tients group) and 73 healthy women as a control group. Descriptive demographic characteristics, major breast cancer risk factors of both the breast cancer patients and health control subjects, in addition to clinicopathological features of the breast cancer patients are summar-ized in Table 1. The two groups were similar in mean BMI. Age at menarche of both groups was also comparable. 14 (23.7%) of the pa-tients had positive family history of breast cancer. As for breast cancer cases, the majority of patients were diagnosed with advanced stage disease 39 (65.0%); with involvement of lymph nodes 40 (66.7%); or with invasive ductal carcinoma 63 (94.0%). Furthermore, 27 (50.9%) and 21 (40.4%) of the patients were positive for estrogen receptor and progesterone receptor respectively.
    3.2. PCR-RFLP analysis of the two SNPs
    Based on the methodological details described in the previous sec-tion under the subtitle “Polymerase Chain Reaction - Restriction Fragment Length Polymorphism”, the best conditions were used for template am-plification and digestion of the PCR product. This successfully revealed the three different patterns generated for each of the two investigated SNPs. The homozygous variant genotype (TT) in rs3020314, signifying the presence of restriction sites at the point of the SNP, two fragments were produced (501 and 202 bp). The homozygous wild type (wt) genotype (CC), signifying the absence of restriction sites, and a frag-ments of 703 bp was produced; accordingly the heterozygous genotype (CT) produced three fragments (703, 501 and 202 bp). For rs1643821,